1/13. Disseminated histoplasmosis causing reversible gaze palsy and optic neuropathy.Subacute disseminated histoplasmosis is an uncommon entity. Typical neuro-ophthalmologic manifestations are usually secondary to histoplasmomas or encephalitis. A 45-year-old man noted blurred vision while receiving empiric antituberculosis therapy for fever and diffuse granulomatous disease of unknown origin. Vertical-gaze palsy, right horizontal-gaze paresis, and mild right optic neuropathy were found on neuro-ophthalmologic examination. Further questioning revealed a history of frequent contact with fighting cocks from south america. Magnetic resonance images were consistent with multiple hemorrhagic infarcts, areas of inflammation, or both, and cerebral angiography showed changes consistent with vasculitis. A previously obtained biopsy specimen from the duodenum was restained and found to be positive for fungal elements. serum antigen titers for histoplasma capsulatum demonstrated evidence of active infection. This case is a rare example of a supranuclear ocular motility disturbance and optic neuropathy secondary to an occlusive vascular process in a patient with subacute disseminated histoplasmosis.- - - - - - - - - - ranking = 1keywords = antigen (Clic here for more details about this article) |
2/13. Disseminated BCG infection following bone marrow transplantation for X-linked severe combined immunodeficiency.An 8-month-old boy with X-linked severe combined immunodeficiency (XSCID) developed disseminated bacille Calmette-Guerin (BCG) infection following BCG vaccination at birth. He initially presented with an abscess at the site of BCG vaccination and was begun on three-drug antituberculous treatment (rifampicin, isoniazid, and pyrazinimide). Dissemination was subclinical prior to a human leukocyte antigen (HLA)-identical bone marrow transplant (BMT) from his sister, following which he presented with an acute erythroderma. A skin biopsy specimen revealed granulomas with epithelial histiocytes and giant cells in the reticular dermis, and numerous acid-fast bacilli (AFB) were present on Ziehl-Nielsen stain. A diagnosis of disseminated BCG disease was made. Despite the addition of a fourth antituberculous agent, ethambutol, he did not recover and developed numerous skin abscesses over the following weeks. Examination of pus from these lesions demonstrated numerous AFB. clarithromycin was added as a fifth antituberculous agent. Despite five-drug antituberculous therapy and monthly intravenous immunoglobulin infusions, recurrent abscesses containing AFB developed intermittently until 7 months posttransplant. At follow-up 1 year post-BMT he showed good general physical improvement. All abscesses had healed with scarring, and no further skin lesions had occurred.- - - - - - - - - - ranking = 1keywords = antigen (Clic here for more details about this article) |
3/13. Previous tuberculosis, hepatitis c virus and lichen planus. A report of 10 cases, a causal or casual link?We report 10 cases of lichen planus (LP) and chronic liver disease linked to HCV. The mean age was 63.4 /- 5.1 years (range 51-73), five were female; six patients had an established cirrhosis of the liver, as shown by either a liver biopsy or the ultrasonographic and biohumoral evidence. The remaining four patients had chronic hepatitis. Histological examination confirmed the presence of LP: the localization of the dermatosis was restricted to the skin in four patients, to the mucous membranes in five (4 atrophic erosive and one erosive) while the remaining had mucous-cutaneous localization. A type II cryoglobulinemia was demonstrated in two and a type III in one of the patients, while no one had otherwise circulating autoantibodies (anti-nuclear, anti-smooth muscle, anti-liver kidney microsomal type 1 and anti-mitochondrial antigens) such as other etiological factors of liver disease. In six of the patients the history was positive for previous mycobacterium tuberculosis infection. In clinical practice the patients with chronic liver disease and HCV infection can also suffer from severe extrahepatic manifestations, including lichen planus.- - - - - - - - - - ranking = 1keywords = antigen (Clic here for more details about this article) |
4/13. mycobacterium tuberculosis infection within Warthin's tumor: report of two cases.We report two patients with Warthin's tumor who were also infected with mycobacterium tuberculosis. Case 1 was a 75-year-old woman with Warthin's tumor and multiple small epithelioid granulomas with caseous necrosis involving the submandibular gland. This patient died of tuberculous meningitis 4 months after biopsy. Case 2 was a 78-year-old man with a 10-year history of a parotid mass which had enlarged rapidly over 2 months. Surgical excision revealed Warthin's tumor and epithelioid granulomas involving the left parotid gland. dna extracted from paraffin sections was amplified by nested polymerase chain reaction (PCR) with primer sets for the mycobacterial 65-KDa antigen gene. Restriction enzyme digestion of the PCR products could differentiate mycobacterium tuberculosis from other mycobacteria in both cases. Although the histogenesis of lymphoid components of Warthin's tumor is controversial, the frequent prevalence of inflammation or necrosis and our present findings suggest these components have a similar behavior to regional lymph nodes.- - - - - - - - - - ranking = 1keywords = antigen (Clic here for more details about this article) |
5/13. Clinical application of the polymerase chain reaction for a rapid diagnosis of mycobacterium tuberculosis infection.A gene amplification method of mycobacterium tuberculosis dna by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3'. The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conventional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the dna from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.- - - - - - - - - - ranking = 1keywords = antigen (Clic here for more details about this article) |
6/13. A case of neoplastic angioendotheliomatosis: angiotropic lymphoma.An autopsy case of neoplastic angioendotheliomatosis (NAE) in a 65-year-old male is reported. At autopsy, the paraaortic lymph node was slightly enlarged, and bilateral swelling of adrenal glands was found. Histologically, multifocal proliferation of atypical cells was seen in the sinusoid or in the lumen of blood vessels throughout many organs, but there was little invasion of the parenchyma by these cells. From these findings, it was diagnosed as NAE. Immunohistochemically, these atypical cells showed positive reaction to the antileukocyte common antigen, anti-MB-1, LN-1, and LN-2, and negative reaction to the anti-Ki-1, anti-MT-1, anti-kappa, anti-lambda, and antifactor-VIII-related antigen. These findings showed that the atypical cells of NAE were of B lymphocyte origin.- - - - - - - - - - ranking = 2keywords = antigen (Clic here for more details about this article) |
7/13. Extensive necrosis in malignant lymphoma with granulomatous reaction mimicking tuberculosis.Epithelioid cell granulomas occur in association with a wide range of neoplasms but necrotizing granulomas mimicking tuberculosis are less well recognized. Two cases of high-grade malignant lymphoma of Burkitt type are presented which were associated with such a response. In both cases this caused difficulty in interpretation and in one led to delayed diagnosis. Regional lymph nodes were not involved by lymphoma but contained epithelioid cell granulomas in both cases. Features that suggested that the granulomatous reaction was related to the tumour included a close spatial relation, the reticulin pattern in the areas of necrosis and the immunohistochemical demonstration of lymphoid antigens in the necrotic debris. A diligent search for mycobacteria and other micro-organisms failed to reveal any infective cause. We suggest that the local granulomatous response is a reaction to the presence of necrotic and poorly viable tumour and the granulomas in nearby lymph nodes may be a response to tumour derived debris.- - - - - - - - - - ranking = 1keywords = antigen (Clic here for more details about this article) |
8/13. Fatal BCG infection in an immunocompetent girl.A 6-year-old girl developed progressive symptoms of increased intracranial pressure starting 5 months after BCG vaccination. Thirteen months later craniotomy revealed an epithelioid cell granuloma of the arachnoid occluding the foramen of Magendie. No tubercle bacilli were found on histological examination. Insertion of a Pudenz shunt relieved the symptoms. Six months later generalized BCG infection developed, and in spite of treatment with ethambutol, rifampicin and isoniazid for 10 weeks, death occurred during an episode of increased intracranial pressure. Mycobacterium BCG could be cultured from several organs. The patient showed no obvious evidence of immuno-deficiency as judged on the basis of previous disease history, particle concentration of granulocytes, B and T lymphocytes in peripheral blood, concentration of immunoglobulins in serum, response of lymphocytes to transformation with mitogens and antigens, and histological findings in the thymus and BCG granulomas.- - - - - - - - - - ranking = 1keywords = antigen (Clic here for more details about this article) |
9/13. Deficiency of immunity to mycobacterium avium that can be restored by allogeneic lymphocytes.A 3-year-old girl developed a disseminated mycobacterium avium infection despite treatment with eight antimycobacterial drugs. She had no pre-existent general humoral or cellular immunodeficiency. In the course of the disease B lymphocyte areas in the lymphoid tissues were replaced by histiocytes and an IgM and iga deficiency evolved. The patient still made antibodies to concomitant micro-organisms and to transfused blood cells. Peripheral blood mononuclear cells (PBMC) had normal responses to mitogens and various antigens in vitro. However, she lacked any response to mycobacterial antigens, in vivo and in vitro. The defect appeared not to be dependent on immunosuppression by lymphocytes or monocytes or on deficient antigen presentation by monocytes. because a genetic origin could not be substantiated, acquired immunological paralysis for mycobacterial antigens was the most likely explanation. Addition of irradiated PBMC from her HLA-A, -B, -C and -DR phenotypically identical father, transferred a response to mycobacterial antigens of the patient's PBMC in vitro. We concluded that the disseminated M. avium infection was accompanied by a selective deficiency of the lymphocyte response to mycobacterial antigens which could be restored by allogeneic antigen responsive lymphocytes.- - - - - - - - - - ranking = 7keywords = antigen (Clic here for more details about this article) |
10/13. Dissociation of helper/inducer T-cell functions: immunodeficiency associated with mycobacterial histiocytosis.Mycobacterial histiocytosis is a generally fatal disease characterized by abundant amounts of undigested atypical mycobacteria present within tissue macrophages that diffusely infiltrate the affected lymph nodes. The immune functions of a 22-year-old man with infection due to mycobacterium avium were investigated. Although the patient had a marked increase in serum immunoglobulin levels and detectable antibodies toward mycobacterial antigens, he had no cellular response to these antigens both in vivo and in vitro. There was an elevated proportion of blood cells with the helper/inducer (T4 ) phenotype, but these cells showed a markedly decreased response to several T-cell mitogens, as well as to autologous and allogeneic cells. The patient's lymphocytes produced diminished amounts of immune interferon, and there was no detectable interleukin 2 (IL-2) activity after stimulation with phytohemagglutinin (PHA). The proliferative response of T4 cells to pokeweed mitogen (PWM), however, was normal; 47% of these cells bore the Tac antigen, and the production of IL-2 using PWM was within the normal range. No phenotypical or functional abnormalities were found in peripheral blood monocytes. These findings suggest a dissociation of helper/inducer T-cell functions with intact B-cell help, but an impaired ability to activate tissue macrophages or to produce immune mediators.- - - - - - - - - - ranking = 3keywords = antigen (Clic here for more details about this article) |
| | Next -> |